Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Case Report
Case Series
Editorial
Guest Editorial
Letter to Editor
Meta Analysis
Original Article
Review Article
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Case Report
Case Series
Editorial
Guest Editorial
Letter to Editor
Meta Analysis
Original Article
Review Article
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Case Report
Case Series
Editorial
Guest Editorial
Letter to Editor
Meta Analysis
Original Article
Review Article
View/Download PDF

Translate this page into:

Original Article
ARTICLE IN PRESS
doi:
10.25259/ABMH_3_2026

Computational Analysis of CRISPR-Cas9 Mediated Therapeutic Targeting in Alzheimer’s Disease

Department of Medicine, Ala-Too International University, Bishkek, Kyrgyzstan

*Corresponding author: Shafee Ur Rehman, Medicine, Ala-Too International University, Bishkek, Kyrgyzstan. shafeeur.rehman@alatoo.edu.kg

Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Ur Rehman S. Computational Analysis of CRISPR-Cas9 Mediated Therapeutic Targeting in Alzheimer’s disease. Acad Bull Ment Health. doi: 10.25259/ABMH_3_2026

Abstract

Objectives:

The neurodegenerative disease Alzheimer’s disease (AD) causes progressive brain deterioration through amyloid-beta accumulation, tau hyperphosphorylation, and neuroinflammatory responses. Scientists have studied Alzheimer’s disease for multiple decades, yet they have not developed any treatment that can cure the condition. The genome-editing tool Clustered regularly interspaced short palindromic repeats associated protein 9 (CRISPR-Cas9) is a powerful technology that scientists use to make precise modifications to disease-related genes. The current research lacks a complete computational assessment of CRISPR targets and their therapeutic potential for treating Alzheimer’s disease. In the current study, we investigate computational CRISPR-Cas9 genome-editing methods targeting vital Alzheimer’s disease-related genes to evaluate their guide RNA sequences, biological pathway effects, and gene network responses.

Material and Methods:

In the current study, data on AD-related genes were retrieved from OMIM, DisseNET, and AlzGene, and differential expression analysis was conducted on the bulk RNA-seq dataset GSE33000. We used CHOPCHOP and CRISPOR to design guide RNAs (gRNAs) targeting APP, PSEN1, APOE, and TNF, and Cas-OFFinder to predict potential off-target effects. The researchers performed pathway enrichment through Enrichr and DAVID. The researchers constructed a fundamental gene regulatory network in Cytoscape and then ran Boolean simulations to predict gene-editing outcomes.

Results:

The study of differential expression showed that APP, PSEN1, PSEN2, TNF, and CLU genes exhibited increased expression in Alzheimer’s disease brain tissue. The designed gRNAs exhibited high on-target performance, with scores exceeding 85, and minimal predicted off-target effects. The pathway enrichment analysis identified amyloid processing, tau phosphorylation, cholesterol metabolism, and inflammation as critical biological processes. The Boolean simulations showed that APP knockout blocked the Aβ and Tau pathways, TNF knockout reduced neuroinflammation, and APOE4→3 correction restored cholesterol homeostasis and reduced inflammation to some extent.

Conclusion:

The computational study demonstrates that CRISPR-Cas9 technology enables researchers to manage vital disease mechanisms in Alzheimer’s disease. The combination of multiple editing strategies yields better therapeutic outcomes. The research findings create a foundation for experimental validation and logical development of CRISPR-based treatments for neurodegenerative diseases.

Keywords

Alzheimer’s disease
Computational biology
CRISPR-Cas9
Gene editing
Neurodegeneration

INTRODUCTION

The progressive neurodegenerative disorder Alzheimer’s disease (AD) leads to permanent destruction of memory functions, cognitive abilities, and behavioral patterns.[1,2] The disease serves as the primary reason for dementia, which affects 60–80% of dementia patients and generates major healthcare costs worldwide.[2] The core pathological elements of AD consist of amyloid-beta (Aβ) plaques located outside cells and tau protein tangles found inside cells, together with synaptic damage and ongoing brain inflammation.[3] The available medical treatments for Alzheimer's disease help manage symptoms, but they do not address the core biological processes that lead to disease progression.[4] The last twenty years of genomic research have identified critical genetic elements that determine Alzheimer's disease susceptibility.[5]The combination of APP and PSEN1 and PSEN2 gene mutations results in early-onset familial Alzheimer's disease, but APOE ε4 allele variants increase the risk of developing late-ons et alzheimer's disease.[2-5] Multiple risk loci have been identified through Genome-Wide Association Studies (GWAS) and meta-analyses, which include CLU, BIN1, PICALM, SORL1, and CR1 genes that influence lipid metabolism and synaptic plasticity, and immune system regulation.[2-6] The discovery of these genetic elements shows potential for developing gene-specific treatments which could alter disease progression through specific molecular pathways.

The clustered regularly interspaced short palindromic repeats–CRISPR-associated protein 9 (CRISPR-Cas9) genome editing system has revolutionized DNA sequence modification in living cells because of its precise and efficient operation.[7-9] The technology demonstrates strong potential to treat genetic disorders, which include neurodegenerative diseases. The CRISPR system allows scientists to eliminate disease-triggering genetic mutations, repair genetic mutations, and manage gene expression that affects AD.[10]The success of CRISPR-based AD therapy depends on developing suitable guide ribonucleic acids (gRNAs) and performing. thorough off-target assessments and understanding gene interactions and pathway responses.[11]The development of CRISPR-based therapeutic methods for Alzheimer's disease treatment needs computational biology tools to evaluate and enhance before laboratory testing.[12]Researchers use gene expression data together with pathway analysis and network modelling to identify vital targets, predict treatment outcomes, and simulate therapeutic responses.[13] The development of gRNA designs becomes possible through tools like CHOPCHOP and CRISPOR, CasOFFinder, and Cytoscape, which enable researchers to predict gene-editing effects on cellular pathways using Boolean and dynamic models.[14] The treatment of Alzheimer's disease requires genetic analysis because the condition involves multiple genetic factors, which need multiple gene targets for successful therapy.

The research conducts a complete computational assessment of CRISPR-Cas9 genome editing for AD treatment. The researchers performed database searches and literature reviews to identify candidate genes before using AD brain tissue expression data to create gRNAs that demonstrated high specificity and minimal off-target activity. The researchers performed pathway enrichment analysis and gene regulatory-Cas9 editing of APP, PSEN1, APOE, and TNF genes to create enhanced network simulations, which demonstrated how gene editing would impact biological systems. The research shows that combining CRISPR effects on amyloid processing, inflammation, and lipid metabolism could result in superior gene therapies for Alzheimer’s disease. This study does not represent clinical gene editing but rather provides an in-silico prioritization framework.

MATERIAL AND METHODS

Gene prioritization and literature curation

We obtained AD-associated genes from multiple reliable sources, which included the AlzGene database and Online Mendelian Inheritance in Man (OMIM), disease gene network database (DisGeNET), and recent GWAS. The research focused on genes that play essential roles in amyloid processing (APP, PSEN1, PSEN2) and lipid metabolism (APOE, CLU, SORL1) and synaptic transmission (PICALM, BIN1), and immune response (TNF, CR1). The research team chose new targets through the analysis of risk loci published in PubMed-indexed literature from 2020 to 2025.

Gene expression analysis

The National Center for Biotechnology Information (NCBI) gene expression omnibus provided transcriptomic data under accession ID GSE33000, which included 310 AD samples and 314 control samples from human prefrontal cortex tissue. The R package limma performed differential expression analysis on the data. The analysis identified genes with p-values below 0.05 and absolute log2 fold change values greater than 1 as differentially expressed. The top 20 differentially expressed genes were displayed through a heatmap made with seaborn, and a volcano plot showed the complete range of expression variations in expression levels.

Guide RNA (gRNA) design and off-target prediction

The CHOPCHOP (v3) and CRISPOR tools generated CRISPR-Cas9 guide RNAs for target genes that researchers had chosen. The researchers chose gRNAs that showed high on-target performance and displayed minimal predicted off-target effects. Human genome analysis using CasOFFinder identified potential off-target binding sites with 3 or fewer mismatches. The analysis continued with gRNAs that achieved on-target scores above 85 and showed no coding off-targets. The researchers employed two editing methods, including exonic knockout for gene knockout and APOE4→APOE3 allele-specific correction. Off-target prediction was performed using Cas-OFFinder against the human reference genome assembly GRCh38/hg38, allowing identification of potential off-target binding sites with up to three mismatches. The use of the latest genome assembly ensured improved genomic coverage and accurate annotation of coding and non-coding regions during off-target assessment.

Functional enrichment and pathway analysis

The analysis of differentially expressed genes and CRISPR-targeted genes used DAVID, Enrichr, and g: Profiler for GO and KEGG pathway enrichment. The visualization of biological processes and pathways used horizontal bar plots to display -log10 false discovery rate (FDR) significance values. The researchers studied core AD pathways, which included Aβ formation and tau phosphorylation, cholesterol metabolism, neuroinflammation, and synaptic function.

Gene regulatory network construction

The researchers built a gene interaction network through Cytoscape while adding GeneMANIA data for annotation. The network contained genes and pathway elements as nodes, which showed regulatory relationships and biochemical dependencies through directed edges. The network displayed core CRISPR targets through colored nodes, which also showed downstream functional outputs and supporting interactors. The network model contained 15 nodes, which formed 18 directed edges to represent essential Alzheimer’s-related signalling pathways.

Boolean simulation of gene editing scenarios

A basic Boolean model served to predict how CRISPR-Cas9 gene editing affects five downstream functions, including Aβ accumulation and tau pathology, neuroinflammation and cholesterol dysregulation, and synaptic dysfunction. The model used binary ON/OFF states to represent pathway nodes across four intervention conditions, which included wild-type (no editing) and APP knockout, TNF knockout, and APOE4→APOE3 correction. The Python-based simulation produced heatmaps to show how different editing scenarios affect pathway activation states.

RESULTS

Prioritization of alzheimer’s disease-associated genes

The researchers used OMIM, AlzGene, and DisGeNET databases and GWAS meta-analysis to identify 14 candidate genes for further investigation. The genes APP, PSEN1, and PSEN2, and APOE received high priority because they directly influence amyloidogenesis and cause early-onset familial Alzheimer’s disease. The research selected CLU, PICALM, BIN1, SORL1, CR1, and TNF genes because they affect synaptic transmission, lipid metabolism, and neuroinflammation. The research included TP53 and PLEC as emerging targets because systems biology studies have identified them as potential therapeutic candidates [Table 1].

Table 1: Core genes with strong genetic evidence
Gene Role in AD
APOE ε4 allele strongly increases risk; homozygotes may develop early AD (cause, not just risk)
APP Mutations cause early onset AD, increase Aβ42/Aβ40 ratio
PSEN1 Mutations cause severe familial, early-onset AD
PSEN2 Also linked to familial early-onset AD

AD: Alzheimer’s disease

Differential gene expression analysis in Alzheimer’s brain tissue

The GSE33000 dataset (n = 624 prefrontal cortex samples) showed that AD patients had widespread changes in their gene expression patterns when compared to healthy controls. The researchers found 376 genes that showed significant differential expression (adjusted p-value < 0.05; |log2FC| > 1) between AD brains and control brains. The researchers found that APP and PSEN1, TNF, and CLU showed increased expression in AD brains, but SORL1 and BIN1 showed decreased expression. The volcano plot displayed the most important genes that showed significant changes. The top 20 differentially expressed genes showed different expression patterns between AD patients and control subjects through heatmap clustering [Figure 1 and Table 2].

Volcano plot of differentially expressed genes in Alzheimer’s disease (AD). Highlights upregulated and downregulated genes in AD brain tissue (GSE33000). Significant genes like APP, PSEN1, TNF, and CLU are clearly visualized.
Figure 1:
Volcano plot of differentially expressed genes in Alzheimer’s disease (AD). Highlights upregulated and downregulated genes in AD brain tissue (GSE33000). Significant genes like APP, PSEN1, TNF, and CLU are clearly visualized.
Table 2: Differential expression summary (Top 10)
Rank Gene log2 FC Adjusted p-value
1 APP 1.73 2.4 × 10-6
2 PSEN1 1.51 3.1 × 10-5
3 TNF 1.44 7.8 × 10-5
4 CLU 1.32 1.2 × 10-4
5 BIN1 –1.28 2.3 × 10-4
6 CR1 1.22 4.1 × 10-4
7 SORL1 –1.18 6.7 × 10-4
8 PICALM 1.16 9.9 × 10-4
9 APOE 1.05 1.5 × 10-3
10 PSEN2 1.02 2.1 × 10-3

Adjusted p-value < 0.05. FC: Fold change

Guide RNA design and off-target analysis

The researchers used CHOPCHOP and CRISPOR tools to create gRNAs for APP, PSEN1, TNF, and APOE. The chosen gRNAs demonstrated high on-target performance (≥86) and low off-target potential. The CRISPOR score for the APP gRNA (5’ GTGCTGAGCGTCTTCAGACG 3’) reached 89.5 while showing no predicted coding off-target sites. The researchers successfully designed allele-specific correction gRNAs, which could transform APOE4 into APOE3 while minimizing potential off-target effects, thus proving the practicality of precision editing [Figure 2 and Table 3].

CRISPR gRNA efficiency and off-target score, presented as a heatmap. It summarizes on-target scores (gRNA efficacy), off-target counts (specificity), and gRNA type (knockout or correction, noted at the bottom) gRNA: Guide ribonucleic acid
Figure 2:
CRISPR gRNA efficiency and off-target score, presented as a heatmap. It summarizes on-target scores (gRNA efficacy), off-target counts (specificity), and gRNA type (knockout or correction, noted at the bottom) gRNA: Guide ribonucleic acid
Table 3: gRNA designs and Off-target scores
Gene gRNA (5’→3’) On target score Predicted high risk off targets
APP GTGCTGAGCGTCTTCAGACG 89.5 0
PSEN1 CGTACGAGACGTTTGTCTGA 91.2 1 (intronic)
APOE4→3 GACCTGCGGAGGTTGGACAA 86.7 0
TNF CAGGTTCTCTAGATGGCACA 88.0 2 (non coding)

gRNA: Guide ribonucleic acid

Functional enrichment and pathway analysis

The GO and KEGG pathway enrichment analysis of differentially expressed and CRISPR-targeted genes demonstrated significant enrichment of multiple AD related pathways (FDR < 0.01). The analysis identified Aβ formation and tau-protein kinase activity, cholesterol transport, endocytosis, and pro-inflammatory signalling as the most significant pathways. The Enrich analysis demonstrated that the Nuclear Factor kappa B (NF-κB) -TNF/NF-κB signalling pathway and synaptic vesicle cycling showed the most significant enrichment in neuroinflammatory processes. The results validate APP and PSEN1, APOE, and TNF as therapeutic targets for AD treatment [Figure 3, 4 and Table 4].

Heatmap of top 20 differentially expressed genes. Displays normalized expression (Z-score) across 10 AD and control samples. Clusters gene expression into disease-specific signatures. Genes such as BIN1, SORL1, and APOE show distinct expression trends. AD: Alzheimer’s disease
Figure 3:
Heatmap of top 20 differentially expressed genes. Displays normalized expression (Z-score) across 10 AD and control samples. Clusters gene expression into disease-specific signatures. Genes such as BIN1, SORL1, and APOE show distinct expression trends. AD: Alzheimer’s disease
Bar plot of top enriched pathways (–log10 FDR). Shows top KEGG/GO pathways enriched among DEGs and CRISPR targets. Includes: Amyloidogenesis, tau signaling, neuroinflammation, cholesterol metabolism, endocytosis, and synaptic signaling. FDR: False discovery rate.
Figure 4:
Bar plot of top enriched pathways (–log10 FDR). Shows top KEGG/GO pathways enriched among DEGs and CRISPR targets. Includes: Amyloidogenesis, tau signaling, neuroinflammation, cholesterol metabolism, endocytosis, and synaptic signaling. FDR: False discovery rate.
Table 4: Pathway enrichment (Top 6)
Pathway –log10 FDR Key genes
Tau pathway 14.8 MAPT, PSEN1, PSEN2
Cholesterol metabolism 14.5 APOE, CLU, SORL1
Amyloidogenesis 12.7 APP, BACE1, PSEN1
Neuroinflammation 10.4 TNF, CR1
Synaptic signalling 9.1 BIN1, PICALM
Endocytosis 6.1 PICALM, SORCS1

FDR: False discovery rate

Network modelling and visualization

The Cytoscape platform enabled researchers to construct a gene regulatory network comprising 15 nodes and 18 directed edges, which represented known relationships between selected genes and their associated pathways. The network revealed that APP, PSEN1, APOE, and TNF function as central hub genes, controlling Aβ production, tau phosphorylation, cholesterol regulation, neuroinflammation, and synaptic dysfunction. The network analysis through node centrality demonstrated that APP and APOE function as primary regulators which makes them suitable targets for therapeutic intervention [Figure 5].

Gene regulatory network (Cytoscape-style). Nodes represent genes and pathways; edges represent regulatory interactions. Central regulators: APP, APOE, PSEN1, TNF. Outputs: Aβ tau, cholesterol, synapse, inflammation.
Figure 5:
Gene regulatory network (Cytoscape-style). Nodes represent genes and pathways; edges represent regulatory interactions. Central regulators: APP, APOE, PSEN1, TNF. Outputs: Aβ tau, cholesterol, synapse, inflammation.

Boolean simulation of CRISPR editing scenarios

Boolean models simulated how CRISPR interventions would affect five Alzheimer’s disease-related phenotypic outcomes. The five pathways operated in an active state when the system operated under normal conditions. The removal of APP genes blocked both amyloid and tau protein production, while TNF knockout specifically reduced neuroinflammatory responses. The APOE4 to APOE3 correction improved cholesterol handling and reduced inflammation to some extent. The results indicate that using CRISPR to edit multiple genes simultaneously produces better therapeutic outcomes than editing a single gene at a time [Table 5 and Figure 6].

Table 5: Summary of key findings
Intervention Tau Inflamm- ation Chole- sterol Synapse
Wild-Type ON ON ON ON ON
APP knockout OFF OFF ON ON ON
TNF knockout ON ON OFF ON ON
APOE4→3 Correction ON ON OFF OFF ON
Boolean simulation heatmap of CRISPR-Cas9 interventions. Rows: Editing scenarios (WT, APP KO, TNF KO, APOE4→3 correction). Columns: Functional outputs (Aβ tau, neuroinflammation, cholesterol, synapse). The binary matrix (ON/OFF) clearly shows the effects of each intervention. AD: Alzheimer’s disease
Figure 6:
Boolean simulation heatmap of CRISPR-Cas9 interventions. Rows: Editing scenarios (WT, APP KO, TNF KO, APOE4→3 correction). Columns: Functional outputs (Aβ tau, neuroinflammation, cholesterol, synapse). The binary matrix (ON/OFF) clearly shows the effects of each intervention. AD: Alzheimer’s disease

The results support the hypothesis that CRISPR-Cas9 gene editing can be a feasible and targeted therapeutic approach for Alzheimer’s disease. The network-based simulation confirms the potential for personalized, multi-gene editing strategies tailored to patient-specific risk profiles.

DISCUSSION

The neurodegenerative disorder AD continues to spread as an untreatable condition that requires new therapeutic methods that focus on genetic and molecular disease mechanisms.[2-15] The research used CRISPR-Cas9 gene editing to study AD by performing a complete computational analysis, which combined gene expression data with guide RNA development and network modelling and Boolean simulation methods.[16] The research shows that CRISPRCas9 gene editing of APP and PSEN1, APOE, and TNF genes can effectively modify essential AD-related biological pathways, which include Aβ formation, tau phosphorylation, inflammation, and lipid metabolism disturbances. Although CRISPR-Cas9 has shown remarkable potential for therapeutic genome editing, its clinical utility in AD remains largely experimental.[15] Current applications are mainly limited to in-vitro neuronal systems and animal models due to major translational challenges, including safe delivery across the blood–brain barrier, off-target genome alterations, long-term safety considerations, and ethical concerns regarding permanent genetic modification. Therefore, the present study should be considered a computational framework for target prioritization and mechanistic exploration rather than direct evidence of clinical treatment feasibility.

The GSE33000 dataset showed that AD patients exhibited elevated expression of APP and PSEN1, and TNF in their prefrontal cortex, which matches previous research about these genes' involvement in amyloid processing and immune system activation.[17,18] The decreased expression of SORL1 and BIN1 genes confirms their essential roles in endosomal trafficking and synaptic function.[19,20] The observed expression patterns confirm our gene selection approach and demonstrate why researchers should focus on both established (APP) and emerging (TNF) disease-causing genes in AD research.[18] In this study, we created high-performance gRNAs with minimal off-target effects for each candidate gene through modern CRISPR technology. The in-silico results showed that APOE4 to APOE3 allele-specific correction proved effective because it reduced cholesterol problems and neuroinflammatory responses.[2-21] The treatment method uses precision medicine to benefit people who have the APOE4 allele because it targets their specific genetic risk. Mechanistically, CRISPR-Cas9 editing relies on guide RNA sequences that direct the Cas9 endonuclease to specific genomic loci, where targeted DNA cleavage occurs. Gene disruption (e.g., APP or TNF knockout) is typically achieved through non-homologous end joining (NHEJ), which introduces insertions or deletions leading to functional gene silencing.[22] In contrast, allele-specific correction strategies, such as APOE4 to APOE3 conversion, aim to exploit homology-directed repair or next-generation precision editing approaches, including base or prime editing.

The targeted genes show extensive connections through biological pathways that control AD development according to pathway enrichment and gene network analysis.[22] The biological processes of lipid transport (APOE, CLU) and amyloidogenesis (APP, PSEN1) and synaptic vesicle trafficking (BIN1, PICALM) and inflammation (TNF, CR1) are all connected through these genes.[23] The regulatory network design showed how APP and APOE function as central regulatory elements in the system. Boolean simulations showed that individual gene knockout operations produce specific effects on disease progression, where APP knockout decreased both Aβ and Tau levels, and TNF knockout blocked neuroinflammatory reactions.[24] The research indicates that complete therapeutic success requires multiple gene editing targets.

Despite the promising computational predictions presented in this study, several real-world barriers currently limit the clinical translation of CRISPR-based therapies for Alzheimer’s disease. One of the major challenges is the efficient delivery of genome-editing systems across the blood-brain barrier (BBB), which restricts the penetration of large biomolecules into the central nervous system.[11-25]

Viral vectors such as adeno-associated viruses (AAVs), lipid nanoparticles, and exosome-based delivery platforms are under active investigation, yet each presents limitations related to immunogenicity, payload size, tissue specificity, and long-term safety.[26] Additional concerns include potential off-target editing, immune responses to Cas proteins, and ethical considerations surrounding permanent genomic modification in neuronal tissues. Therefore, while the present study provides a computational framework for identifying promising targets, substantial technological and safety advancements are required before clinical application becomes feasible. Prospective human studies involving CRISPR-based genome editing for AD are not yet feasible at a clinical scale. A realistic translational pathway would involve sequential validation beginning with computational modelling, followed by experiments in induced pluripotent stem cell (iPSC)-derived neurons and animal models, before consideration of early-phase clinical trials. This staged approach is essential to establish safety, delivery efficiency, and therapeutic efficacy before human application.

The promising in silico results need to be evaluated against multiple factors that limit their application. The binary models used in our simulations fail to represent complete gene expression levels and post-translational modifications. The central nervous system delivery of CRISPR requires additional research to address both immune response risks and ethical concerns about germline and somatic editing before medical applications become possible. The study provides computational methods for designing CRISPR treatments in neurodegenerative diseases while creating opportunities for laboratory testing in suitable cell and animal models. The research demonstrates that CRISPR-Cas9 gene editing technology can effectively targ et alzheimer's disease-causing pathways. The combination of transcriptomic data analysis with guide RNA optimization and systems-level modelling demonstrates how precision gene therapies can target multiple disease-causing genes effectively. Researchers need to develop combination delivery methods and conduct extended safety and effectiveness tests while confirming their results through human iPSC-derived neurons and AD mouse models. The Boolean modelling framework employed in this study provides a simplified systems-level representation of pathway activity using binary ON/OFF states. While this approach facilitates conceptual understanding and hypothesis generation, it does not capture quantitative gene expression dynamics, graded signalling responses, or post-translational regulatory mechanisms. Future studies integrating dynamic or probabilistic modelling may provide higher biological fidelity.

CONCLUSION

The research through computational methods shows that CRISPR Cas9 gene editing technology holds promise for treating AD through disease modification. Our research combines multiple methods to demonstrate that the four genes APP, PSEN1, APOE, and TNF represent critical targets because they control amyloidogenesis and tau pathology, lipid regulation, and neuroinflammatory responses. The designed gRNAs show high on-target performance (≥ 86) while minimizing predicted coding off-target effects, which makes precise in vivo editing possible. Network and pathway analysis show that single-gene modifications create specific therapeutic effects, but complete disease treatment requires multiple gene editing approaches. The Boolean model predicts that APP knockout will stop Aβ and tau production, while TNF knockout will reduce inflammation, and APOE4 to APOE3 conversion will restore cholesterol balance and reduce inflammation. In summary, this computational study establishes a systematic in-silico pipeline for evaluating CRISPR-Cas9 strategies targeting Alzheimer’s disease-associated genes. The findings suggest that combined editing of APP, PSEN1, APOE, and TNF may theoretically influence amyloid pathology, neuroinflammation, and lipid dysregulation. Nevertheless, these observations represent predictive computational outcomes and must be validated through experimental and preclinical studies before clinical application. The framework presented here aims to support future translational research toward safe and effective precision gene therapies for neurodegenerative diseases.

Acknowledgement:

The author would like to express sincere gratitude to Alatoo International University for its continuous support and encouragement of academic research.

Authors’ contributions:

SUR: Collected the data and wrote the manuscript.

Ethical approval:

The Institutional Review Board approval is not required for this study was an in-silico/computational analysis based exclusively on publicly available databases and published literature, with no human participants, patient data collection, or animal experimentation.

Declaration of patient consent:

Patient's consent is not required as there are no patients in this study.

Conflicts of interest:

There are no conflicts of interest.

Use of artificial intelligence (AI)-assisted technology for manuscript preparation:

The author confirm that they have used artificial intelligence tools Grammarly and OpenAI for language editing and structuring of the manuscript under the author’s supervision. All scientific content, interpretations, and conclusions are the responsibility of the author.

Financial support and sponsorship: Nil.

References

  1. , , , , , , et al. Overexpressed microRNA-455-3p enhances cognitive function in late-onset alzheimer's disease. Brain Res. 2025;149853
    [CrossRef] [PubMed] [Google Scholar]
  2. , , , , . The role of gene expression alterations, non-coding RNAs, copy number variations, and splicing in Alzheimer's disease. J Anim Plant Sci. 2025;35:1467-78.
    [Google Scholar]
  3. , , . Morphological and molecular profiling of amyloid-ß species in Alzheimer's pathogenesis. Mol Neurobiol. 2025;62:4391-419.
    [CrossRef] [PubMed] [Google Scholar]
  4. , , , , , , et al. Treatment for Alzheimer's disease. Lancet. 2025;406:1408-23.
    [CrossRef] [PubMed] [Google Scholar]
  5. , , , , , , et al. Alzheimer disease is (sometimes) highly heritable: Drivers of variation in heritability estimates for binary traits, a systematic review. PLoS Genet. 2025;21:e1011701.
    [CrossRef] [PubMed] [Google Scholar]
  6. , , , , , , et al. Identification and characterization of variants in PSEN1, PSEN2, and APP genes in Chinese patients with early-onset alzheimer's disease. Alzheimers Res Ther. 2025;17:1-8.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , . Gene editing and CRISPR-dependent homology-mediated end joining. Exp Mol Medi. 2025;57:1409-18.
    [CrossRef] [PubMed] [Google Scholar]
  8. . Revolutionizing HIV/AIDS treatment: Advances in CRISPR/Cas9. Braz J Pharm Sci. 2025;61:e24485.
    [CrossRef] [Google Scholar]
  9. , , , , , , et al. Applications of CRISPR-Cas9 in mitigating cellular senescence and age-related disease progression. Clin Exp Med. 2025;25:1-21.
    [CrossRef] [PubMed] [Google Scholar]
  10. . Advancement in gene therapy: Current and future of gene therapy. Kashmir J Sci. 2025;4
    [CrossRef] [Google Scholar]
  11. , , , , . CRISPR/Cas9-based therapeutics as a promising strategy for management of Alzheimer's disease: Progress and prospects. Front Cell Neurosci. 2025;19:1578138.
    [CrossRef] [PubMed] [Google Scholar]
  12. , , , , . CRISPR/Cas9 and iPSC-based therapeutic approaches in Alzheimer's disease. Antioxidants. 2025;14:781.
    [CrossRef] [PubMed] [Google Scholar]
  13. , , , , . From data to cure: A comprehensive exploration of multi-omics data analysis for targeted therapies. Mol Biotechnol. 2025;67:1269-89.
    [CrossRef] [PubMed] [Google Scholar]
  14. , . CRISPR-Cas9 and its bioinformatics tools: A systematic review. Curr Issues Mol Biol. 2025;47:307.
    [CrossRef] [PubMed] [Google Scholar]
  15. , , , , , , et al. Unraveling molecular and genetic insights into neurodegenerative diseases: Advances in understanding Alzheimer's, Parkinson's, and Huntington's diseases and amyotrophic lateral sclerosis. Int J Mol Sci. 2023;24:10809.
    [CrossRef] [PubMed] [Google Scholar]
  16. , . Aging genome modification and editing using the CRISPR-Cas9 system: Anti-Alzheimer study by docking methods. Biointerface Res Appl Chem. 2022;13:224.
    [CrossRef] [Google Scholar]
  17. , , , , . Unveiling immune-related feature genes for Alzheimer's disease based on machine learning. Front Immunol. 2024;15:1333666.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , , et al. Identification of early Alzheimer's disease subclass and signature genes based on PANoptosis genes. Front Immunol. 2024;15:1462003.
    [CrossRef] [PubMed] [Google Scholar]
  19. , , , , . Cell type-specific functions of Alzheimer's disease endocytic risk genes. Philos Trans R Soc B. 2024;379:20220378.
    [CrossRef] [PubMed] [Google Scholar]
  20. , . A comprehensive review on novel opportunities for Alzheimer therapy by targeting BIN1. Egypt J Med Hum Genet. 2025;26:134.
    [CrossRef] [Google Scholar]
  21. , , , , , , et al. Unique lipid cargoes in APOE4 human brain-derived extracellular vesicles recruit cell adhesion molecules and promote tauopathy in Alzheimer's disease. Res Sq 2025:rs-3.
    [CrossRef] [Google Scholar]
  22. , , , , . Identifying hub genes and miRNAs associated with Alzheimer's disease: A bioinformatics pathway to novel therapeutic strategies. Biomolecules. 2024;14:1641.
    [CrossRef] [PubMed] [Google Scholar]
  23. , . Protective genes against Alzheimer's disease: Case review and therapeutic implications. Dement Neurocogn Disord. 2025;24:75.
    [CrossRef] [PubMed] [Google Scholar]
  24. , , , , , , et al. Revisiting the critical roles of reactive microglia in traumatic brain injury. Int J Surg. 2025;111:3942-78.
    [CrossRef] [PubMed] [Google Scholar]
  25. , , , , , , et al. CRISPR-Cas9: A promising genome editing therapeutic tool for Alzheimer's disease-A narrative review. Neurol Ther. 2020;9:419-34.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , , , , et al. Exosome-mediated delivery of gene vectors for gene therapy. Nanoscale. 2021;13:1387-97.
    [CrossRef] [PubMed] [Google Scholar]
Show Sections